인문학
사회과학
자연과학
공학
의약학
농수해양학
예술체육학
복합학
DBpia AI
AI 에이전트
AI 아이디어
AI 리더
AI 뷰어
Citeasy
크롬 서지관리 다운로드
지원사업
학술연구/단체지원/교육 등 연구자 활동을 지속하도록 DBpia가 지원하고 있어요.
커뮤니티
연구자들이 자신의 연구와 전문성을 널리 알리고, 새로운 협력의 기회를 만들 수 있는 네트워킹 공간이에요.
초록·키워드
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
인공지능 문자 인식 모델을 통해 추출된 텍스트로, 일부 오타나 오류가 포함될 수 있으나 지속적으로 개선 중입니다.
오류를 발견하셨다면 해당 부분을 드래그한 후 ' 를 통해 신고해주세요.
오류를 발견하셨다면 해당 부분을 드래그한 후 ' 를 통해 신고해주세요.
최근 본 자료 전체보기
